🔥The 9th Round of Easy Loan, Earn $40 Reward is in progress❗️ ⏰ Promotion Period: January 15th - Feburary 15th, 2025 👉 Register now and check more details at gate.io/campaigns/358

A much improved version of this, today out in Nature Genetics ! with Ben Lehner and Fran Supek nature.com/articles/s4158…

The genetic architecture of protein stability by Andre Faure @ajfaure.bsky.social Aina Martí cristina hidalgo-carcedo @ToniBeltran13 Joern Schmiedel nature.com/articles/s4158… Centre for Genomic Regulation (CRG) Wellcome Sanger Institute ALLOX

🧪 Are you passionate about molecular cloning? 🧬 Are you interested in applying ingenious methods for generating mutant libraries? 💊 Are you excited to join an exceptional team of scientists committed to revolutionising drug discovery? If so, here is a new job opportunity 👇

GCAAGGACATATGGGCGAAGGAGA, las 24 letras cruciales en el surgimiento del autismo. Científicos del IRB Barcelona han descubierto un mecanismo que podría explicar un elevado porcentaje de los trastornos del espectro autista: elpais.com/ciencia/2024-1…

I am incredibly excited to announce that our project with Ben Lehner, Thomas Wilhelm, and the Centre for Genomic Regulation (CRG) #TBDO has been awarded a Proof of Concept Grant from European Research Council (ERC)! Huge thanks to everyone involved for their ongoing support – let's boost the science!

VISCA CATALUNYA!💪🏻🏆

Thank you Benedetta Bolognesi Mafalda Dias Jonathan Frazer for inviting me to share how we fit thermodynamic models to DMS data at this 8th MSS workshop 🙏🏼! It’s been a pleasure to share the floor with Noelia Ferruz and Pascal Notin and learn lots from them 👨🏻‍💻!

🤯 Mapping energy couplings in the Aβ42 nucleation transition state? 💪🏼 No problem for crack team Anna Arutyunyan Mseu Andre Faure @ajfaure.bsky.social Ben Lehner & Benedetta Bolognesi! 🧠 A massive tour-de-force in Alzheimer’s & neurodegeneration research — 📄 check out the paper and Anna’s awesome thread!