🔥The 9th Round of Easy Loan, Earn $40 Reward is in progress❗️ ⏰ Promotion Period: January 15th - Feburary 15th, 2025 👉 Register now and check more details at gate.io/campaigns/358

Read about our journey to build a DNA-based platform for data storage and computation in the The New Yorker. Thank you for the wonderful article Matthew Hutson!

Asimov Press. Book Unboxing. Encoded in English and DNA. Designed by Everything Studio | Brooklyn, NY Printed by Shapco | Minneapolis, MN Published by Asimov Press | San Francisco, CA CATGATGACAGCTAGCGTCTAAGCCATTGTTGTTCGACG

🧬 SNIA’s April newsletter is live and we spy DNA data storage! Join us for Storage and Computing with DNA – Paris, France – June 19-21, 2025. 👉 mailchi.mp/5ab5a1931332/s…

Passing along an opportunity for the DNA data storage community! The Library of Congress has officially posted a Request for Information as it is exploring innovative preservation methods for its digital collections. Responses are due by April 21st: sam.gov/opp/adc4a2ac1f…

🧬 Passing along this information for New Trends in DNA Based Data Storage in Prague this summer. Reminder that registration and abstract submission is due the 9th of May. Find the speaker list and all the details here: jh-inst.cas.cz/dbds25/index.h…

Our latest quarterly newsletter is out now! DNA Data Storage continues to make progress on multiple fronts. Here’s what’s happening within the Alliance and in the industry right now. Read it here 👉 mailchi.mp/1014a65c8851/b… DNA Data Storage Alliance

Welcome to the DNA Data Storage Alliance 2025 latest quarterly newsletter! DNA Data Storage continues to make progress on multiple fronts. Here’s what’s happening within the Alliance and in the industry right now. DNA Data Storage Alliance, #DNAdatastorage linkedin.com/pulse/top-news…

The Library of Congress issued a call for proposals as it is exploring innovative preservation methods for its digital collections. Read more about the opportunity and find instructions for submitting your proposal below👇 sam.gov/opp/fa83133fe6…

🎙️Podcast alert! SNIA experts discuss the innovations, challenges, & importance of data storage solutions & standards to handle ever-growing digital demands. Why Data Storage Matters More Than Ever: snia.org/podcasts#WDSMa… DNA Data Storage Alliance

New white paper! This white paper provides an overview of the state of DNA data storage technology, the metrics important to measuring commercial readiness, & the challenges to reaching commercial readiness. DNA Data Storage Technology Review: snia.org/educational-li… SNIA

Excited to see our recent white papers front and center in SNIA’s July newsletter! Read about the latest in DNA data storage here: mailchi.mp/50345f36b024/s… DNA Data Storage Alliance

The 1st ever Storage And Compute with DNA conference was a success! The conference served as a platform to exchange ideas, discuss recent advancements, & explore potential synergies across research & commercial applications for next-gen data storage & computational solutions.

There's a lot of great info in the July issue of the SNIA Newsletter. Get updates on how to join new SNIA technical work, DNA data storage white papers, SDC news, SNIA Plugfests and more. ow.ly/xh4M50Wopxo

Thank you to StorageNewsletter for highlighting our TWO new white papers! DNA Data Storage Alliance, SNIA storagenewsletter.com/2025/07/16/sni…