🔥The 9th Round of Easy Loan, Earn $40 Reward is in progress❗️ ⏰ Promotion Period: January 15th - Feburary 15th, 2025 👉 Register now and check more details at gate.io/campaigns/358

ATGGAGAGGAGGTACTGCCACAGGATCAGCACCATGGCCAGCGCCAACGACGCCCACGCCCCCCCCTACAACGAGTGGTACGAGGCCAGG from everyone at Ensembl! buff.ly/1Izo5qL

Anderson lab Caltech characterizes threat displays in flies and the sensory cues required for this behavior cell.com/neuron/fulltex… Preview by Gordon Berman cell.com/neuron/fulltex…

“...These observations support the notion that sleep serves metabolic functions...”

Twitter-sized history of neuroscience (biased by my interests).

“The trouble is philosophers love to define things, and then live or die by the definitions they’ve endorsed. People end up talking past each other, or proving things about irrelevant artificial divisions of the world. [...] Definitions are overrated.”

Architecture and subunit arrangement of native AMPA receptors elucidated by cryo-EM science.sciencemag.org/content/early/…

Congratulations to Carsen Stringer (Carsen Stringer @[email protected]), Marius Pachitariu (Marius Pachitariu) and Nick Steinmetz (Nick Steinmetz). Their wonderful findings are now in print: science.sciencemag.org/content/364/64…

Dopamine signalling is important in a number of processes but how it can support them all is unclear. A paper in Nature shows that dopamine release and cell firing may have different functions during reward-related learning. go.nature.com/2HypoK4

cell.com/neuron/fulltex…

Back in town from a few intense days in Cambridge Harvard University - thanks Mackenzie Mathis, PhD and Alexander Mathis for organising a very useful DeepLabCut 🦄 workshop! 🐭 Excited for the next updates!

cell.com/current-biolog…

Do you agree that animal research is essential in #Biology & #MedicalResearch? 📢The EU will be discussing a complete ban of animal research - Please support this initiative pro animal research in Europe & spread the word 🙏 braincouncil.eu/pledge-for-sci…

It was an honour to meet the Italian ambassador to the UK the other day!

⁦Crick Science Entrepreneur Network (CSEN)⁩ x ⁦NeuroTechX⁩ are hosting a NeuroTech Spotlight ✨🧠✨ event at ⁦The Francis Crick Institute⁩, discussing all things neuroscience x technology! (Incredible guests, exciting startups, and obviously drinks 🥂) Join us (2nd Feb) ➡️ lu.ma/6mgm7mu0

*Potentially* exciting development from neuro research: BullFrogAI partners with the Lieber Institute, the world’s largest collection of human brain samples, uncovering (unprecedented) AI-led insights at gene level into neuropsychiatric conditions ⏬ ir.bullfrogai.com/news-events/pr…

Autonomous Science enables entirely *new types* of discovery and economics. We've concluded edge cases - prion research, high-risk pathogen research, geoengineering - and autonomous CRO's - optimization and scale-up - are the best place to start company building. In order to

Today, a landmark study from Institute for Protein Design announced its progress toward creating AI-designed enzymes. owl and eryney marrogi explain how their method provides a roadmap for creating other types of dynamic, moving proteins. Read here: asimov.press/p/ai-enzymes

Very provocative 😏

Announcing Evo 2: The largest publicly available, AI model for biology to date, capable of understanding and designing genetic code across all three domains of life. arcinstitute.org/manuscripts/Ev…