🔥The 9th Round of Easy Loan, Earn $40 Reward is in progress❗️ ⏰ Promotion Period: January 15th - Feburary 15th, 2025 👉 Register now and check more details at gate.io/campaigns/358

An exciting and important story from UCSF Biochemistry's Hani Goodarzi and colleagues identifying SNRPA1 as a recognizer of RNA structures to regulate alternative splicing and promote breast cancer metastasis: science.sciencemag.org/content/372/65…

An awesome profile of UC San Francisco's and Chan Zuckerberg Biohub Network's own Joe DeRisi in The New York Times: nytimes.com/2021/06/03/mag…

Oh, this is going to be an exciting endeavor, and a powerful accelerator of non-model organism biology. Exciting!

❤️ right back at'cha, seemay chou! Science is big and benefits from a wide variety of approaches (and people!).

Wonderful news this morning about our own Hani Goodarzi Hani Goodarzi! He's a recipient of a 2022 #Vilcek Foundation Prize recognizing important #immigrant contributions here in the US. I can't wait to find what other surprises RNA has in store for us! vilcek.co/2022vfpto

Our group kiraposkanzerlab.org is hiring at the postdoc, staff scientist, and technician levels to study physiology of astrocytes and neurons. We want to hear from people with a wide variety of backgrounds and expertise, including those who haven’t studied glia before. 1/2

We are hiring this year! Speaking from personal experience, UCSF Biochemistry and CMP are parts of a wonderful and supportive community for launching a new lab. We are eager to learn about a broad diversity of science. Come join us! aprecruit.ucsf.edu/JPF03596

Published today in Science Magazine, UCSF’s Walter lab and collaborators describe how a stress sensor directs cells to make corrections when proteins get misfolded and threaten cellular health. science.org/doi/10.1126/sc…

Hooray! Wonderful recognition of the pioneering work of #UCSF’s @DJuliusSF and also Ardem Patapoutian! Heartiest congratulations, both! Understanding TRP channels is a fundamental advance in how cells sense their worlds and communicate to the rest of the organism. Thank your TRPs!

Wow! Wonderful new crew that the NIH has recognized with New Innovator awards, including our own Vijay Ramani Vishnu Ram, Daniele Canzio and Dan Wagner Dan Wagner at #UCSF. Congratulations, and I can't wait to watch the fascinating ways in which you build on this opportunities!

Wonderful news of UCSF Biochemistry's David Booth, and his newly minted Packard Fellowship. Packard Fellows are a community of extremely disparate areas of science, making for extensive cross-pollination.

Apply for a TT job with us in #UCSF Biochem! The deadline is looming, and I'd love for you to be part of this great, supportive, creative community! aprecruit.ucsf.edu/JPF03596

Great to have Dr. Jeeyun Chung, PhD presenting on “How cells deal with fat: Mechanisms of lipid storage and mobilization” today at noon in Byers Hall!

Happy birthday, David Booth! We all can't wait to learn what you discover next!

Sadly, our friend, colleague, inspiration and leader, Christine Guthrie, died Friday. She was a pioneering scientist, helped build our department, and was beloved. She discovered yeast snRNAs and brilliantly used suppressor screens to elucidate how splicing works. We miss her.

Protocol: 1.Nasal swab into 100ul RNA shield on D2 2.RNeasy RNA isolation 3.iScript RT w/ AAACAGTTGCTGGTGCATGT 4.Phusion (touchdown from 65-62° 30” extension w/ TTTAACGCCACCAGATTTGC and CAGTTGCTGGTGCATGTAGAA) 5.Sequence w/ TGCTTGGAACAGGAAGAGAA and TGCATGTAGAAGTTCAAAAGAAAG

Come join us for a TT position at #UCSF Biochem! A great, dynamic group of supportive faculty and San Francisco is a plus. Deadline is Halloween! aprecruit.ucsf.edu/JPF04089

We will be celebrating the life of Christine Guthrie on October 28. All are welcome. Please register at: goodarzilab.ucsf.edu/ChristineGuthr…

One more week to submit your application! Join us here in the Department of Biochemistry and Biophysics at UC San Francisco: aprecruit.ucsf.edu/JPF04089

We are hiring! The department is looking for three people: someone to help with human resources, an executive assistant to the chair, and a postdoc administrator. Details: rb.gy/hrefg6 rb.gy/inqkqp rb.gy/35w0k0