🔥The 9th Round of Easy Loan, Earn $40 Reward is in progress❗️ ⏰ Promotion Period: January 15th - Feburary 15th, 2025 👉 Register now and check more details at gate.io/campaigns/358

🌏🎗️#WorldBreastCancerDay | Every medical advance we have today comes from years of research. At #IRBBarcelona, Dr. GomisLab's team discovered the MAF gene, key to #BreastCancer #metastasis. Learn how this breakthrough is advancing towards the clinic with Inbiomotion SL.

A very important paper by Karuna Ganesh and dana_peer describing the plastic cell states of metastatic CRC. Glad to see it published finally. Congratulations!!

An exciting opportunity to join a fantastic team @ersiliaio carrying out very interesting activities #Postdoc #Research

Catalan tradition The BATLLE Lab . Panellets de Tots Sants. A tradition originated in the XVIII century

👩🏻‍🔬👀🤹🏻‍♀️🥘Este próximo viernes 22 de noviembre, únete a la gala solidaria organizada por Alipanc para apoyar la investigación de cáncer de páncreas. Cena, coloquio, rifa y hasta concierto! Si no puedes venir, también puedes colaborar desde la fila 0 💜

📢Registrations are open for the #BarcelonaBiomed Conference "#AI in #DrugDiscovery & Biomedicine"! 👉31 Mar-2 Apr, 2025 📍Casa Convalescència #Barcelona ✅Organized by @ptck72 (#IRBBarcelona) & Trey Ideker (UC San Diego) 🤝Fundación BBVA Register now➡️rb.gy/ggpjtz

🚀Avui comença la Setmana de la Ciència a Catalunya! Divulgació, activitats, tallers i xerrades per a totes les edats entorn la #ciència. Descobreix la programació i participa-hi! 🔍 📅Del 8 al 17/11 #SetmanaCiencia2024 🔗 Més info: setmanaciencia.fundaciorecerca.cat

✍️ Próximas conferencias #QuéSabemosDe en Barcelona, en la Residència d'Investigadors: - Lunes 11 nov: 'Inmunonutrición', con Ascensión Marcos, del ICTAN-CSIC ➡️ csic.es/es/agenda-del-… - Martes 12 nov: 'La ciencia y la cocina', con Marta Miguel, del CIAL ➡️ csic.es/es/agenda-del-…

El cáncer no actúa solo; engaña a las células que lo rodea para usarlas en su propio beneficio. Aprende cómo el microentorno tumoral es esencial en la lucha contra el cáncer y cómo Cajal señaló su importancia. 👇 view.genially.com/653608bdd6c260… #InvestigaresAvanzar

Highly recommended

Unidos por la vida! Unidos contra el cáncer de páncreas! Alipanc Teresa Macarulla Tamara Sauri Berta Laquente lvisa Fabio Ausania Paula Cerdà Paula Ribera Helena Verdaguer Mata CNIO Stop Cancer

Join us Roche's Institute of Human Biology (IHB) as a Scientific Group Leader! Lead innovative research in #HumanModelSystems such as #Organoids. We especially seek applications aligned to our commitment to diversity and inclusion.  More go.roche.com/11jc8  #TeamIHB #pRED

🎯At CaixaForum in Madrid. 🙌🏼Thank you very much CaixaResearch & Fundación ”la Caixa” for the support to our research on #metastasis and #colorectalcancer relapse. #CancerResearch #CaixaResearch

The hallmarks of cancer immune evasion dlvr.it/TG8BBS

1/ 🎉 We present the projects selected in the #CaixaResearch Health Call 2024. 29 cutting-edge biomedical research projects led by research centres, hospitals and universities in Spain and Portugal. 👇 tinyurl.com/5yr3z7ms

“The path to #Health is paved with #Science” Powerful message by CaixaResearch

Adapmet is an amazing consortium working on cancer and metastasis and offers PhD positions. If you want to perform a PhD in these topics (either in academia or industry), please apply for these positions through the website interface before January 9th. Please forward the post!

🫧🔍Key breakthrough in #autism: pivotal role of #CPEB4 condensates revealed. 💊The study opens new avenues for the development of targeted treatments for autism. 📰nature ✍️ Carla GC Anna Bartomeu et al. ➡️bit.ly/3OLesKV 📌DOI: 10.1038/s41586-024-08289-w

GCAAGGACATATGGGCGAAGGAGA, las 24 letras cruciales en el surgimiento del autismo. Científicos del IRB Barcelona han descubierto un mecanismo que podría explicar un elevado porcentaje de los trastornos del espectro autista: elpais.com/ciencia/2024-1…

Three #BISTCommunity researchers receive European Research Council (ERC) Consolidator Grants #ERCCoG for their innovative projects, with €2M over five years 🏅Direna Alonso-Curbelo IRB Barcelona 🏅César Rodriguez-Emmenegger IBEC 🏅Arnau Sebé-Pedrós Centre for Genomic Regulation (CRG) bist.eu/three-bist-com…