🔥The 9th Round of Easy Loan, Earn $40 Reward is in progress❗️ ⏰ Promotion Period: January 15th - Feburary 15th, 2025 👉 Register now and check more details at gate.io/campaigns/358

the genome rambler Amusingly, if you map Q61 (SRA SRR23971449) to the MERS genome using minimap2, you also get 1 matching read. MERS+ : AATTTAAAATATGCTATTAGTGCTAAGAATAGAGCCCGCACTG SARS-CoV-2+ : TCAAGTCCATGGTAATGCACATGTAGCTAGTTGTGATGCAATC You can check yourself with Galaxy Project (or BLAST).

Don’t, use HyPhy instead. PAML doesn’t allow for synonymous rate variation across sites or multiple simultaneous nucleotide mutations, ignoring these will give you wrong results…

Check our next evaluation of chatgpt: jamanetwork.com/journals/jaman… Basically, ChatGPT needs more work to help with urgent public health resources like suicide prevention and addiction.

Small update on this: We've run a few more variants against a slightly larger "recent" cohort, including XBB.1.5 with F456L, and with L455F+F456L ("FLip"). No surprises there. We also include DV.7.1. If you struggle to remember DV.7.1, you can use its other name, which is...(1/n)

1 What's the right balance for data sharing vs data privacy? For HIV, sharing VIRAL genetic data has numerous ethical challenges. HIV-status is PHI. Sequence data can (and have!) been used in criminal transmission cases. journals.plos.org/PLoSmedicine/a…

So stoked that my Pyodide pysam PR has been merged. 🏄‍♂️

The HyPhy wasm module has been incorporated into biowasm. Really excited about the potential here.

Excited to share our latest paper on optimizing genetic distance thresholds for inferring HIV-1 transmission networks. Our heuristic scoring approach adapts to diverse epidemics with an aim of improving identification of clusters & aiding public health interventions.

The fully peer-reviewed, accepted AUTO-TUNE manuscript has now been published in Frontiers in Bioinformatics -- frontiersin.org/journals/bioin….

Glad to have taught at eebgschool.org and experience the next wave of Eastern European bioinformatics. Thank you to Serghei Mangul #UkraineWillWin 🇺🇦🇲🇩🇺🇸 and all of the organizers

Teaching molecular adaptation at #VEME2024, among the best scientists in the world for pandemic response.

Such a pleasure to attend this event. Learned a lot about NCBI resources for antimicrobial resistance.

💔 My first job in software development. Veoh Networks

1/ Genome-wide (and other) positive selection screens in genomes may be severely biased by alignment and other errors. biorxiv.org/content/10.110… we (Avery Selberg, Nathan Clark nclark.bsky.social, Maria Chikina, Anton Nekrutenko 🇺🇦, Steven Weaver, Alexander G Lucaci, Tim Sackton) propose a simple fix.

In Mexico City, I found food warning labels helpful.

I used to sit in the seats in front of the dugout along first base at Jack Murphy Stadium once a month thanks to my friend’s dad. Ricky would always talk to us and give us baseballs. Not only was he fun to watch, but his kindness to fans has made an impression on me to this day.