🔥The 9th Round of Easy Loan, Earn $40 Reward is in progress❗️ ⏰ Promotion Period: January 15th - Feburary 15th, 2025 👉 Register now and check more details at gate.io/campaigns/358

x.com/i/spaces/1dRJZ…

Continuing to build for BNBChain and working hard to help users earn more LP rewards! Thank you BNB Chain BNB Chain 華語 and Four.Meme for your support UpTop is on its way to the top!

Liquidity LP rewards shouldn’t be a privilege for the few they should be a benefit shared by all users! Keep building BNB Chain CZ 🔶 BNB Yi He

Weekends are great times to plot great things. #uptop

🔸 UpTop.meme

We are excited to announce that the outstanding Four.meme project $TST is officially launching on UpTop! Starting from June 2, UpTop will open high-yield liquidity pool slots for TST/BNB, offering liquidity providers the following triple rewards: 1. Base APR of

🚀 UpTop is leveling up liquidity farming — launching high-yield $TST/BNB LP slots on June 2! Test Token Liquidity providers get triple rewards: 🔸 35% base APR (subsidized by Four.Meme) 🔸 35% TGE airdrop bonus 🔸 ~33% PancakeSwap fee sharing UpTop x

Congratulations to our dear partner Four.Meme , and welcome WLFI for providing incentive rewards to support liquidity on BNB Chain . Huge thanks to all the users who contributed to the BNB/USD1 liquidity pool through #UpTop!

Thanks to BSCDaily for the share this chart is incredibly professional!

The time is getting closer here’s to a bright future!

Uptop is now officially live on Binance Wallet , jump in and experience it instantly!@BinanceWallet

Uptop is officially live on Binance Wallet.

Uptop is continuously moving forward and now holds a 48% share in the BNB/USD1 V2 liquidity pool! WLFI BNB Chain

We should go create miracles and those miracles belong to UpTop!

This DNA sequence could potentially be embedded in the human genome. “CTCCCTAACTCACGTTCTAATGCGGCCAGTGCTGCCGATTGCGATGCGGCTAGGGGTGCGGCTCGGCCTGTTGTTAGATATGCCGTGTGTGGTGGAGGTGGTTGCGAGCGTGCGAGCGATCGGACGACCGGCCGTGTGTTGTTAGAAC”

not as tapped in w/ eastern CT but seems like they have their own adjacent pump.fun ecosystem w/ Four.Meme is CZ pumping any of the memes over there on BNB

⚠️ Beware of fake UpTop tokens! ⚠️ We have already identified hundreds of fake UpTop tokens circulating externally. These are not affiliated with us and may pose scam or phishing risks. Please only trust information from our official Twitter: UpTop.meme Do not click on

If you were part of the Uptop team, which platform would you partner with for the TGE, and what TGE model would you go for? #uptop #TGE